Partenaires

CNRS


Rechercher


Accueil > Publications > Recherche par années > Années 2000 > 2002

Barbault, F ; Huynh-Dinh, T ; Paoletti, J ; Lancelot, G

A new peculiar DNA structure : NMR solution structure of a DNA kissing complex

Journal of Biomolecular Structure & Dynamics 19 (4) 649-658

par Administrateur - publié le

Abstract :

The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV-1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degreesC) was found slightly higher than the one of the corresponding RNA dimer (32 degreesC).