Partenaires

CNRS


Rechercher


Accueil > Publications > Recherche par années > Années 2000 > 2002

2002

Page(s) : < | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |

A hyperthermostable D-ribose-5-phosphate isomerase from Pyrococcus horikoshii characterization and three-dimensional structure

A gene homologous to D-ribose-5-phosphate isomerase (EC 5.3.1.6) was found in the genome of Pyrococcus horikoshii. D-ribose-5-phosphate isomerase (PRI) is of particular metabolic importance since it catalyzes the interconversion between the ribose and ribulose forms involved in the pentose phosphate cycle and in the process of photosynthesis. The gene consisting of 687 by was overexpressed in Escherichia coli, and the resulting enzyme showed activity at high temperatures with an optimum over 90 C. The crystal structures of the enzyme, free and in complex with D-4-phosphoerythronic acid inhibitor, were determined. PRI is a tetramer in the crystal and in solution, and each monomer has a new fold consisting of two a/ß domains. The 3D structures and the characterization of different mutants indicate a direct or indirect catalytic role for the residues E107, D85, and K98.

Lire la suite

A medium-throughput crystallization approach

The first results of a medium-scale structural genomics program clearly demonstrate the value of using a medium-throughput crystallization approach based on a two-step procedure : a large screening step employing robotics, followed by manual or automated optimization of the crystallization conditions. The structural genomics program was based on cloning in the Gateway(TM) vectors pDEST17, introducing a long 21-residue tail at the N-terminus. So far, this tail has not appeared to hamper crystallization. In ten months, 25 proteins were subjected to crystallization ; 13 yielded crystals, of which ten led to usable data sets and five to structures. Furthermore, the results using a robot dispensing 50-200 nl drops indicate that smaller protein samples can be used for crystallization. These still partial results might indicate present and future directions for those who have to make crucial choices concerning their crystallization platform in structural genomics programs.

Lire la suite

A new peculiar DNA structure : NMR solution structure of a DNA kissing complex

The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV-1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degreesC) was found slightly higher than the one of the corresponding RNA dimer (32 degreesC).

Lire la suite

Accelerating water exchange for GdIII chelates by steric compression around the water binding site

The water exchange process was accelerated for nine-coordinate, monohydrated macrocyclic Gd-III complexes by inducing steric compression around the water binding site ; the increased steric crowding was achieved by replacing an ethylene bridge of DOTA(4-) by a propylene bridge ;double dagger in addition to the optimal water exchange rate, the stability of [Gd(TRITA)(H2O)](-) is sufficiently high to ensure safe medical use which makes it a potential synthon for the development of high relaxivity, macromolecular MRI contrast agents.

Lire la suite

Amino acids from ultraviolet irradiation of interstellar ice analogues.

Amino acids are the essential molecular components of living organisms on Earth, but the proposed mechanisms for their spontaneous generation have been unable to account for their presence in Earth’s early history. The delivery of extraterrestrial organic compounds has been proposed as an alternative to generation on Earth, and some amino acids have been found in several meteorites. Here we report the detection of amino acids in the room-temperature residue of an interstellar ice analogue that was ultraviolet-irradiated in a high vacuum at 12 K. We identified 16 amino acids ; the chiral ones showed enantiomeric separation. Some of the identified amino acids are also found in meteorites. Our results demonstrate that the spontaneous generation of amino acids in the interstellar medium is possible, supporting the suggestion that prebiotic molecules could have been delivered to the early Earth by cometary dust, meteorites or interplanetary dust particles.

Lire la suite

Analysis of the Escherichia coli Tol-Pal and TonB systems by periplasmic production of Tol, TonB, colicin, or phage capsid soluble domains

The aim of this review is to describe an in vivo assay of the interactions taking place in the Tol-Pal or TonB-ExbB-ExbD envelope complexes in the periplasm of Escherichia coli and between them and colicins or g3p protein of filamentous bacteriophages. Domains of colicins or periplasmic soluble domains of Tol or TonB proteins can be artificially addressed to the periplasm of bacteria by fusing them to a signal sequence from an exported protein. These domains interact specifically in the periplasm with the Tol or TonB complexes and disturb their function, which can be directly detected by the appearance of specific tol or tonB phenotypes. This technique can be used to detect new interactions, to characterize them biochemically and to map them or to induce tol or tonB phenotypes to study the functions of these two complexes. 0 2002 Societe francaise de biochimie et biologie moleculaire / Editions scientifiques et medicales Elsevier SAS. All rights reserved.

Lire la suite

Apoptosis induction and DNA interstrand cross-link formation by cytotoxic trans-[PtCl2(NH(CH3)(2))(NHCH(CH3)(2))] : Cross-linking between d(G) and complementary d(C) within oligonucleotide duplexes

We have investigated the cytotoxic activity, the induction of apoptosis, and the interstrand cross-linking efficiency in the A2780cisR ovarian tumor cell line, after replacement of the two NH3 nonleaving groups in trans-[PtCl2(NH3)(2)] (trans-DDP) by dimethylamine and isopropylamine. The data show that trans-[PtCl2(NH(CH3)(2))(NHCH(CH3)(2))] is able to circumvent resistance to cis-[PtCl2(NH3)(2)] (cis-DDP, cisplatin) in A2780cisR cells.

Lire la suite

Page(s) : < | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |